[KevinLam]

Is there an official download source for the updated SOLiD adaptor sequences?
The one I am using is from the bioscope example dataset
./applications/wholeTranscriptome.run/.run/reads/human_filter_reference.fasta

looking at this list I think that file which I had previously thought sufficient seems to be quite lacking!
other than the human tRNAs and line repeats,
it lists the 16 barcodes
>adaptor + bc16 + P2
and only
>P1 adaptor.

[yksikaksi]

You can refer to this appendix D (page 206 onwards) of Applied Biosystems SOLiD™ 4 System Library Preparation Guide which covers:
1. Library construction oligonucleotides
2. Adaptor sequences
3. Multiplex adaptor and barcode sequences

[harrike]

You can refer to this appendix D (page 206 onwards) of Applied Biosystems SOLiD™ 4 System Library Preparation Guide which covers:
1. Library construction oligonucleotides
2. Adaptor sequences
3. Multiplex adaptor and barcode sequences

Thank you very much. That's exactly what i want.

[aushev]

What about adaptors used for RNA ligation in "Total RNA-Seq" kit? if I am not wrong, their sequenced are not disclosed here?
Thanks in advance.

[pmiguel]

Yeah, Ambion is playing that pretty close to their vest.

Unfortunate because with the recent major drop in the cost of both Illumina library construction kits and vast increase in the amount of sequence produced per run, I fear the SOLiD may no longer be competitive for RNA seq.

Reagent costs for the SOLiD RNA sequence library construction kit needs to drop down to around $50/sample. The Illumina kit is around $70/sample -- but that includes polyA isolation!

--
Phillip

[aushev]

well, for the moment I am working with microRNA, i.e. don't care about polyA.
(to tell the full story, I am trying to understand if there is a way to make miRNA->cDNA library compatible for both sequencing and qPCR - that's why my question about adapters arose)

[aushev]

ok, finally I found by myself
according to published patent 20100279305, adaptor oligo mix contains
1) 5'-CCUCUCUAUGGGCAGUCGGUGAU (3.1 μM)
2) 5'-NNNNNNATCACCGACTGCCCATAGAGAGG (6.1 μM)
3) 5'-PO4--CGCCTTGGCCGTACAGCAG (3.1 μM)
4) 5'-CTGCTGTACGGCCAAGGCGNNNNNN (6.1 μM)

[aushev]

And this is how they can be aligned to known P1 and internal adapters mentioned in post #2:

P1 Adapter:
1) 5' -------CC ACTACGCCTCCGC TTTCCTCTCTATGGGCAGTCGGTGAT
2) 3' -----TTGG TGATGCGGAGGCG AAAGGAGAGATACCCGTCAGCCACTA NNNNNN

Internal Adapter
3) 5' --------CGTACAtCCGCCTTGGCCGTACAGCAG
4) 3' ------TGGCNNNNNNGCGGAACCGGCATGTCGTC

[ECO]

ok, finally I found by myself
according to published patent [snip]

While patents are a great place to look, I'd caution you that even though it's listed there doesn't mean that's what is in your current kit...!

[aushev]

While patents are a great place to look, I'd caution you that even though it's listed there doesn't mean that's what is in your current kit...!

thanks for cautioning, I totally agree, that's why I indicated the source of data.

[pmiguel]

[...]



4) 3' ------TGGCNNNNNNGCGGAACCGGCATGTCGTC

Where does the 3' terminal "TGGC" come from?

--
Phillip

[aushev]

Where does the 3' terminal "TGGC" come from?
Phillip

Sorry, I didn't make it clear - I meant that TGGC is only in internal adapter, not in this one. Adaptors from the ligation mix are marked in red/magenta.

[pmiguel]

Sorry, I didn't make it clear - I meant that TGGC is only in internal adapter, not in this one. Adaptors from the ligation mix are marked in red/magenta.

Ah, I get it now.

Thanks for your post. I got the extensive patent documentation. I have not carefully read it, but it looks very interesting. ECO had mentioned elsewhere how useful these could be, but I'd never checked for myself.

I am not understanding the motivations for companies to be so secretive about information disclosed publicly in their patent applications. What is up with that?

--
Phillip

[koala]

I'm not sure to understand ... the IA you're speaking about..is the IA given from the hybridization of MPL and MPR adaptors? because I've tried to sequence the IA by Sanger technologies and what I found is that I can read correctly the first bases and the lasts, but in the middle the sequence is a "double-seq"!!

THANKS chiara

[pmiguel]

I'm not sure to understand ... the IA you're speaking about..is the IA given from the hybridization of MPL and MPR adaptors? because I've tried to sequence the IA by Sanger technologies and what I found is that I can read correctly the first bases and the lasts, but in the middle the sequence is a "double-seq"!!

THANKS chiara

The IA (Internal Adapter) is a "center adapter" in SOLiD mate-pair library construction--the one that attaches the two ends of the large DNA fragment into a circle. I don't want to descend into the depths of mate-pair library construction here, but you end up with:

adapter P1-insert1-IA-insert2-adapter P2

, where the inserts are either end of the same long DNA fragment. You prime one read from inside IA, and the other from P1.

For their bar coding strategy for fragment libraries, ABI decided to re-purpose the mate-pair structure:

adapter P1-insert-IA-BC-adapter P2

Then you get your bar code read from the IA-primed read.

I think you are right, in the most recent iteration of ABI's mate pair library construction kit, the IA would be formed by the hybridization of MPL and MPR. They used to just have a double-stranded internal adapter that allowed circularization via a ligation.

--
Phillip