Hello! I have RNA-Seq data and I am processing them with BBtools for adapter trimming, quality trimming, contaminant filtering, error correction. I want to use these data as support in denovo genome assembly with Abyss, which has this ability. Should I normalize them? What is the target number that I should set in bbnorm? Can someone explain how I calculate the right number?
Unconfigured Ad
Collapse
X
-
-
khist.sh assertion error
Hi Brian:
I think this is your preferred place for issue reporting - let me know if I missed some other location.
I've tried to do this to calculate dinucleotide frequencies. Not sure I'm asking for khist something reasonable though.
I was able to do what I want with jellyfish count -s 1000000 -m 2 -t 16 <(samtools fastq tiny.bam) && jellyfish dump -c -t mer_counts_0Code:khist.sh k=2 in=tiny.bam java -ea -Xmx27710m -Xms27710m -cp /home/NEB/langhorst/miniconda2/envs/bbmap/opt/bbmap-37.78/current/ jgi.KmerNormalize bits=32 ecc=f passes=1 keepall dr=f prefilter hist=stdout minprob=0 minqual=0 mindepth=0 minkmers=1 hashes=3 k=2 in=tiny.bam Executing jgi.KmerNormalize [bits=32, ecc=f, passes=1, keepall, dr=f, prefilter, hist=stdout, minprob=0, minqual=0, mindepth=0, minkmers=1, hashes=3, k=2, in=tiny.bam] Settings: threads: 32 k: 2 deterministic: false toss error reads: false passes: 1 bits per cell: 32 cells: 3289.05M hashes: 3 prefilter bits: 2 prefilter cells: 28.34B prefilter hashes: 2 base min quality: 0 kmer min prob: 0.0 target depth: 100 min depth: 0 max depth: 100 min good kmers: 1 depth percentile: 54.0 ignore dupe kmers: true fix spikes: false histogram length: 1048576 print zero cov: false Made prefilter: hashes = 2 mem = 6.60 GB cells = 28.34B used = 0.000% Made hash table: hashes = 3 mem = 12.25 GB cells = 3287.47M used = 0.000% Estimated kmers of depth 1-3: 0 Estimated kmers of depth 4+ : 9 Estimated unique kmers: 9 Table creation time: 38.189 seconds. Exception in thread "Thread-201" Exception in thread "Thread-230" Exception in thread "Thread-229" Exception in thread "Thread-228" Exception in thread "Thread-232" Exception in thread "Thread-231" Exception in thread "Thread-227" java.lang.AssertionError at bloom.KCountArray.makeCanonical2(KCountArray.java:489) at bloom.KCountArray.read(KCountArray.java:135) at jgi.KmerNormalize.generateCoverage(KmerNormalize.java:2752) at jgi.KmerNormalize$ProcessThread.normalizeInThread(KmerNormalize.java:2859) at jgi.KmerNormalize$ProcessThread.run(KmerNormalize.java:2808) ...
but I thought you'd want to know about the assertion.
AA 1652511
AC 369103
AG 388077
AT 1270520
CA 325270
CC 238680
CG 36991
CT 369537
GA 371297
GC 10646
GG 254788
GT 391079
TA 1313592
TC 355048
TG 348502
TT 1676488
Comment
-
Exception in thread "Thread-175" java.lang.AssertionError:
Hello,
Thanks for the great software!
I want to use bbnorm to normalize single end RNAseq library reads.
I'm using the software on my university cluster (linux)
this is the exception message I get:
Exception in thread "Thread-175" java.lang.AssertionError:
NB501112:39:HKM3VBGXY:4:11401:7344:1020 1:N:0:CCAGTT 1 -1 + -1 -1 1000000000000000000 1 0 0 CTTTACATCAAATCCTAATGTAGTTACAGGTGATTCAATTAATCTATCACCTAATGATTGTGAACGTTG EEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEE/EEE . 35 . .
null
at stream.ReadStreamByteWriter.writeFastq(ReadStreamByteWriter.java:460)
at stream.ReadStreamByteWriter.processJobs(ReadStreamByteWriter.java:97)
at stream.ReadStreamByteWriter.run2(ReadStreamByteWriter.java:42)
at stream.ReadStreamByteWriter.run(ReadStreamByteWriter.java:28)
this is the script I used:
#!/bin/bash
#SBATCH -N 1
#SBATCH -n 24
#SBATCH -p hive7d
#SBATCH -J ecc_bbnormSE # Job name
#SBATCH --mem=128000
#SBATCH --time=2-23:00:00 # Runtime in D-HH:MM:SS
#SBATCH --mail-type=ALL # Type of email notification- BEGIN,END,FAIL,ALL
#SBATCH [email protected] # Email to send notifications to
. /etc/profile.d/modules.sh
module purge
module load java/jre1.8.0
export PATH=/data/home/steindler/mbritstei/programs/anaconda2/bin:$PATH
source activate bbtools
fastq_DATA=/data/home/steindler/mbritstei/Petrosia_transcriptomes/transcriptome_assembly/All_Single_end
bbnorm.sh in=$fastq_DATA/petrosia_SE.fastq out= out2=petrosia_SE_normalized_ecc.fastq target=100 min=5 ecc prefilter
source deactivate
## Can you please tell me what is wrong?
# thanks!!
Maya
Comment
-
@Maya: Can you explicitly add -Xmx128g (is that what you are asking for) threads=24 in your bbnorm.sh command?
I also don't understand this part: in=$fastq_DATA/petrosia_SE.fastq out= out2=petrosia_SE_normalized_ecc.fastq There should just be one "out="?
Normalizing RNAseq data is not appropriate. You are going to lose vital count information. See the section on "When not to normalize" in BBNorm guide here.Last edited by GenoMax; 01-27-2019, 05:38 AM.
Comment
-
Thanks @GenoMax
I did not see that "out= " there... will try again, also with the suggested flags.
I'm using the normalization just for assembly, not for quantification.
Comment
-
Hi!!! A question, please.Originally posted by Brian Bushnell View PostI'd like to introduce BBNorm, a member of the BBTools package.
BBNorm is a kmer-based normalization tool for NGS reads, which may also be used for error-correction and generating kmer-frequency plots. It is extremely fast and memory-efficient due to the use of atomic counters and probabilistic data structures.
First, what is normalization? Many assemblers perform poorly in the presence of too much data, and data with irregular coverage, such as MDA-amplified single cells or metagenomes. And even if an assembler performs well with these datasets (Spades, for example, does a very good job with single cells, though still benefits from normalization in my tests), more data will increase the runtime and memory usage, potentially to the point that the data cannot be assembled.
Subsampling randomly discards some percentage of the reads, to reduce the average coverage, and is computationally cheap (you can do that quickly with reformat). However, if you have one area with 10000x coverage and another area with 10x coverage, subsampling to 1% will reduce the 10000x area to 100x - a good level for some assemblers - but the 10x area to 0.1x, which cannot be assembled. So with irregular coverage, it is not ideal!
Normalization discards reads with a probability based on the local coverage. So, for example, if you normalize to a target 40x coverage, reads in regions with 10x coverage will all be retained; in an 80x region they will be discarded with a 0.5 probability; and in a 10000x area they will be discarded with a 0.004 probability. As a result, after normalization, areas with coverage above the target will be reduced to the target, and areas below the target will be left untouched. This generally makes the data much easier to assemble and typically increases continuity (L50) by a substantial amount.
To normalize to 40x coverage with BBNorm, and discard reads with an apparent depth under 2x (which typically indicates the reads have errors):
bbnorm.sh in=reads.fq out=normalized.fq target=40 mindepth=2
Error-correction is also useful in many cases when you have sufficient depth and wish to avoid false-positive variant calls, or achieve a higher mapping rate, or want to merge paired reads via overlap, or assemble high error-rate data with an assembler that is not very tolerant of errors, or reduce the memory usage of a DeBruijn assembler. Like normalization, error-correction is not universally a good idea - JGI does not normalize and error-correct all data prior to use, for example - but it is highly beneficial in many situations. Also, BBNorm only corrects substitution errors, not indels, since that is the error mode that occurs in Illumina data. In other words, it will NOT error-correct PacBio or 454 data, which feature indel errors. BBNorm is currently being used for error-correction by the OLC assembler Omega.
To error-correct reads with BBNorm:
ecc.sh in=reads.fq out=corrected.fq
To error-correct and normalize at the same time, just add the flag "ecc" when running BBNorm.
Lastly, BBNorm can be used for producing kmer frequency histograms, and binning reads based on coverage depth. The histograms are useful to determine things like the ploidy of an organism, the genome size and coverage, the heterozygousity rate, and the presence of contaminants (which typically have drastically different coverage than the genome of interest).
To generate a kmer frequency histogram:
khist.sh in=reads.fq hist=histogram.txt
You can also use the "hist" flag during normalization or error-correction, for the histogram of input reads, for free; "histout" will generate the histogram of output reads, but cost an additional pass.
So, what is the difference between bbnorm.sh, ecc.sh, and khist.sh? They all call the same program, just with different default parameters (you can see the exact parameters by looking at the bottom of the shellscripts). If you specify all parameters manually, they are equivalent.
How does BBNorm work, and why is it better than other tools?
BBNorm counts kmers; by default, 31-mers. It reads the input once to count them. Then it reads the input a second time to process the reads according to their kmer frequencies. For this reason, unlike most other BBTools, BBNorm CANNOT accept piped input. For normalization, it discards reads with probability based on the ratio of the desired coverage to the median of the counts of a read's kmers. For error-correction, situations where there are adjacent kmers in a read with drastically different frequencies - for example, differing by a factor of 180 - are detected; the offending base is altered to a different base, if doing so will restore the kmer to a similar frequency as its adjacent kmers.
BBNorm is memory-efficient because it does not explicitly store kmers - everything is in a probabilistic data structure called a count-min sketch. As a result, BBNorm will never run out of memory, slow down, or use disk, no matter how much data you have or how big the genome is. Rather, the accuracy will decline as the table's loading increases - but because kmers are not explicitly stored, it can store several times more than an explicit data structure (such as Google Sparse Hash). And for normalization, the reduction in accuracy at extremely high loading does not matter, because the median is used - so even if multiple kmers within a read have an incorrectly high count, they will not even be considered, and thus the results will not be affected at all. As a result - in practice, you should use all available memory even for a tiny genome with a small number of reads; but even for a huge genome with very high coverage, BBNorm will still work, and produce good results quickly on a computer with limited memory.
Speedwise, BBNorm is multithreaded in all stages, using atomic counters which do not require locking - this allows it to scale efficiently with processor core counts.
BBTools has another program functionally related to BBNorm, "kmercountexact.sh". It does NOT use probabilistic data structures, and uses locking rather than atomic counters, and as a result may not scale as well, and will run out of memory on large datasets. However, it is still extremely fast and memory-efficient - using ~15 bytes per kmer (with an optional count-min-sketch prefilter to remove low-count error kmers). It cannot normalize or error-correct, but it can generate the exact kmer count of a dataset as well as the exact kmer frequency histogram (and do rudimentary peak calling for genome size estimation). In practice, when I am interested in kmer frequency histograms, I use KmerCountExact for isolates, and BBNorm for metagenomes.
BBNorm (and all BBTools) can be downloaded here:
Download BBMap for free. BBMap short read aligner, and other bioinformatic tools. This package includes BBMap, a short read aligner, as well as various other bioinformatic tools. It is written in pure Java, can run on any platform, and has no dependencies other than Java being installed (compiled for Java 6 and higher).
Edit: Note! Most programs in the BBMap package run in Java 6 or higher, but BBNorm requires Java 7 or higher.
BBNorm can also be used to normalize the coverage of PacBio reads??
Thank you in advance!
edited:
I just read that it indeed can be used on PacBio reads but doesn't perform error-correction! that's fine for me
I have HiFi PacBio reads and wanted to try this normalization step
Last edited by silverfox; 04-10-2020, 03:00 PM.
Comment
-
normalized reads file empty
Hi Brian and everyone! I'm using bbnorm but i keep getting a problem.
I ran the command:
$ bbnorm.sh -Xmx64g t=18 in=pt.raw.fastq out=pt.raw.normalized.fq target=90 mindepth=2
everything looked good but when the proccess ended, I realized the file pt.raw.normalized.fq was empty
edited:
I just run the following command:
$ bbnorm.sh in=pt.raw.fastq out=pt.raw.normalized3.fq target=90 min=2
But at the end, my pt.raw.normalized3.fq file was still empty, like before T-T
I think the problem could be here:
In the second pass says
Please, can someone tell me what did I do wrong?HTML Code:Made hash table: hashes = 3 mem = 65.66 GB cells = 35.25B used = 0.000% Estimated unique kmers: 0 Table creation time: 17.804 seconds. Started output threads. Table read time: 0.012 seconds. 0.00 kb/sec Total reads in: 0 NaN% Kept Total bases in: 0 NaN% Kept Error reads in: 0 NaN% Error type 1: 0 NaN% Error type 2: 0 NaN% Error type 3: 0 NaN% Total kmers counted: 0
Thanks a lot in advance!
Editing:
I just found one of your comments:
I will try to normalize my HiFi PacBio (PacBio CCS) reads thenOriginally posted by Brian Bushnell View PostBBNorm cannot be used for raw PacBio data, as the error rate is too high; it is throwing everything away as the apparent depth is always 1, since all the kmers are unique. Normalization uses 31-mers (by default) which requires that, on average, the error rate is below around 1/40 (so that a large number of kmers will be error-free). However, raw PacBio data has on average a 1/7 error rate, so most programs that use long kmers will not work on it at all. BBMap, on the other hand, uses short kmers (typically 9-13) and it can process PacBio data, but does not do normalization - a longer kmer is needed.
PacBio CCS or "Reads of Insert" that are self-corrected, with multiple passes to drop the error rate below 3% or so, could be normalized by BBNorm. So, if you intentionally fragment your reads to around 3kbp or less, but run long movies, then self-correct, normalization should work.
PacBio data has a very flat coverage distribution, which is great, and means that typically it does not need normalization. But MDA'd single cells have highly variable coverage regardless of the platform, and approaches like HGAP to correct by consensus of multiple reads covering the same locus will not work anywhere that has very low coverage. I think your best bet is really to shear to a smaller fragment size, self-correct to generate "Reads of Insert", and use those to assemble. I doubt normalization will give you a better assembly with error-corrected single-cell PacBio data, but if it did, you would have to use custom parameters to not throw away low-coverage data (namely, "mindepth=0 lowthresh=0"), since a lot of the single-cell contigs have very low coverage. BBNorm (and, I imagine, all other normalizers) have defaults set for Illumina reads.
Can I not reduce the kmer length? (default=31)Last edited by silverfox; 04-12-2020, 06:25 PM.
Comment
-
Multiple Samples for BBNorm
Hi Brian -- How would this work with paired-end reads? Would it be okay to concatenate all forward and all reverse reads then run BBNorm?
Originally posted by Brian Bushnell View PostAt this point, BBNorm does not accept multiple input files (other than dual files for paired reads). You would have to concatenate them first:
cat a.fastq.gz b.fastq.gz > all.fa.gz
...which works fine for gzipped files. Most of my programs can accept piped input from stdin, but not BBNorm since it needs to read the files twice.
Comment
-
Core dump error with BBNorm
Hi all,
I'm using BBNorm to normalize a metagenomic dataset but am getting the following error during 'pass 1':
From manual I assumed that memory shouldn't be an issue, and have given 21G of memory to the job scheduler (slurm).HTML Code:Estimated unique kmers: 15483482031 Table creation time: 1619.850 seconds. Started output threads. /opt/nesi/CS400_centos7_bdw/BBMap/38.90-gimkl-2020a/bbnorm.sh: line 164: 106596 Bus error (core dumped) java -ea -Xmx17653m -Xms17653m -cp /opt/nesi/CS400_centos7_bdw/BBMap/38.90-gimkl-2020a/current/ jgi.KmerNormalize bits=32 t=10 in=S1_all_R1_cpfy_clean.fq.gz in2=S1_all_R2_cpfy_clean.fq.gz out=S1_all_R1_cpfy_clean_norm.fq.gz out2=S1_all_R2_cpfy_clean_norm.fq.gz target=100 min=5
I'm wondering if I'm exceeding my storage with the temporary files that are created by BBNorm, although I should have ~10TB so wouldn't have thought that was the issue.
Any insight on this error would be much appreciated. Thanks in advance!
Sean
Comment
Latest Articles
Collapse
-
by SEQadmin2
CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).
Despite this, “CRISPR helped turn genome editing from a specialized technique into...-
Channel: Articles
Yesterday, 11:01 AM -
-
by SEQadmin2
Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.
The systematic characterization of the human proteome has...-
Channel: Articles
07-20-2026, 11:48 AM -
-
by SEQadmin2
Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
...-
Channel: Articles
07-09-2026, 11:10 AM -
ad_right_rmr
Collapse
News
Collapse
| Topics | Statistics | Last Post | ||
|---|---|---|---|---|
|
Started by SEQadmin2, Yesterday, 02:55 AM
|
0 responses
12 views
0 reactions
|
Last Post
by SEQadmin2
Yesterday, 02:55 AM
|
||
|
Started by SEQadmin2, 07-24-2026, 12:17 PM
|
0 responses
12 views
0 reactions
|
Last Post
by SEQadmin2
07-24-2026, 12:17 PM
|
||
|
Started by SEQadmin2, 07-23-2026, 11:41 AM
|
0 responses
13 views
0 reactions
|
Last Post
by SEQadmin2
07-23-2026, 11:41 AM
|
||
|
Started by SEQadmin2, 07-20-2026, 11:10 AM
|
0 responses
24 views
0 reactions
|
Last Post
by SEQadmin2
07-20-2026, 11:10 AM
|
Comment