FASTX-Toolkit: quality score value

[thinkRNA]

I get an error when I use FASTX-Toolkit : Please let me know how to get Fastx to work?

./bin/fastx_clipper -a "ATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAA" -l 5 -k -o test.out -i test.fastq
fastx_clipper: Invalid quality score value (char '#' ord 35 quality value -29) on line 4

this is the test.fastq
@GA6_00012:6:1:5480:933#0/1
NCTGGGCACTGGGGTGCTGTGGGCAGATATGGGCTACAGAACAAGGAAAGACCCTGGTCCCGGAAGGTGCCAGCTG
+
#,,.225425@@5@@22@@@@@@@@(''%%'()'(@@@@@@@@@@@@@@@@@@7@#####################

[simonandrews]

There was another thread very recently which covered this. You need to add the -Q33 parameter to tell it that you're using Illumina encoded quality scores, not Sanger encoding.

[maubp]

There was another thread very recently which covered this. You need to add the -Q33 parameter to tell it that you're using Illumina encoded quality scores, not Sanger encoding.

The other way round

It assumes Illumina (ASCII offset 64), but you have Sanger (offset 33), hence -Q33

See: http://seqanswers.com/forums/showthread.php?t=7399

[mgogol]

Just a note, with Casava 1.8, qualities are switched to offset of 33 in illumina fastq files. So to use these with fastx toolkit, you'll also have to use the -Q33 flag.

[Nanu]

When I am running the command fastq to fasta format through Fastx toolkit..It was showing the following error in 64 bit computer on Linux.
fastq_to_fasta: Invalid quality score value (char '(' ord 40 quality value -24) on line 8

Now please give the solution for this problem.

[Nanu]

When I am running the command for fastq trimmer in fastx toolkit..it was showing the error :

fastx_trimmer: Invalid quality score value (char '(' ord 40 quality value -24) on line 8

Please suggest the solution to resolve this issue.

[maubp]

What was the command you ran Nanu, and did you use the -Q33 flag?

[Nanu]

I ran :
./fastx_trimmer -t 30 -i <filename> -o <filename2>
No I didnt use any flag.
I am new for this..so please guide me how to use -Q33 flag.

[Nanu]

I ran :
./fastx_trimmer -t 30 -i <filename> -o <filename2>

fastq_to_fasta -h -r -v -i <filename.fastq> -o <filename.fasta>

No I didnt use any flag.
I am new for this..so please guide me how to use -Q33 flag.

[maubp]

With the fastx tool kit you must add -Q33 to the command to tell it to use the Sanger FASTQ encoding (with quality score offset of 33). Unfortunately some tools default to the now obsolete Illumina encoding (which used an offset of 64), see http://en.wikipedia.org/wiki/FASTQ_format and http://dx.doi.org/10.1093%2Fnar%2Fgkp1137

[Nanu]

I have Illumina Seq data
Data format:

@HWI-1KL139:40:C0BW5ACXX:1:1102:19408:132180 1:N:0:
TGAACGGACTGGAAACACTGGTCATAATCATGGTGGCGAATAAGTACGCGTTCTTGCAAATCACCAGAAGGCGGTTCCTG
AATGAATGGGAAGCCTTCAAG
+
BCCFFFFDFHGHFIIJJJJJJIIIJGIJJGIJJ?GIHHGHIEGGFHIJJJJGHGHHFFFFFFEEEADDDDDBDB5<?CDD
DDDDCCEDDDDDB<ACDDCCC
@HWI-1KL139:40:C0BW5ACXX:1:1102:19487:132183 1:N:0:
CTGATTCTGAACAGCTTCTTGGGAAGTAGCGACAGCTTGGTTTTTAGTGAGTTGTTCCATTCTTTAGCTCCTAGACCTTT
AGCAGCAAGGTCCATATCTGA
+
@C@FFFDDD?AFDF@GHHHIIGI@@FBEHIIGD:FDFHII??FDG@FHIHE=CGIIE@AFHHEHECA;?=AEFFCBDDED
3>AA@BB(;;:>>>CD>CC@A
@HWI-1KL139:40:C0BW5ACXX:1:1102:19280:132183 1:N:0:
GACTTCACGCCAGAATACGAAAGACCAGGTATATGCACAAAATGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTC
GCGTTGCGTCTATTATGGAAA
+
CCCFFFFFHHHHHJJJJJJIIJJJJJJJJFHIIJJIJJJJJJJJJJIJJJJJGIIJJJJGGGJJJJJHHHHEEDFFFFDE
DDDDDDDDBDDDEEEEDCACD

Where I have to mention it???

[maubp]

From the read naming convention, your Illumina data is using the standard "Sanger" FASTQ encoding.

[mgogol]

Just add it as an argument. I wish this was better documented.

./fastx_trimmer -Q33 -t 30 -i <filename> -o <filename2>

I don't know if this one needs it as well?
fastq_to_fasta -Q33 -h -r -v -i <filename.fastq> -o <filename.fasta>

[Brian Bushnell]

You might want to try Reformat. It automatically detects quality encoding (though you can override it), is much faster than fastx, does a better job of quality-trimming, and does fastq-to-fasta conversion in the same time as quality-trimming. And it keeps paired reads together.